circad | circRNAs associated with diseases

cir-GLI2
Gene	GLI2	Organism	Human
Genome Locus	chr2:121708818-121713006:+	Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	28695772
Experimental Method
Sample Type	Tissues	Comparison	Osteosarcoma (OS) tissues and adjacent non-tumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGGCGACGGTCAGCGTT Reverse GGCAATGGCGACCGTTATAC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, JF, Song, YZ (2017). Circular RNA GLI2 promotes osteosarcoma cell proliferation, migration, and invasion by targeting miR-125b-5p. Tumour Biol., 39, 7:1010428317709991.